Glossaire de quelque termes en bioinformatique

De EduTech Wiki
Aller à : navigation, rechercher

Glossaires et définitions de quelques termes

  • Base / banque de données Serveur informatique regroupant et permettant d'accéder à un grand nombre de données notamment de séquences mais aussi de bibliographie etc...
  • Bioinformatique Utilisation d'outils informatiques pour gérer et analyser des données biologiques.
  • BLAST Algorithme informatique et serveur permettant de faire des recherche de similarité à partir d'une séquence (protéine ou nucléique) sur toutes les séquences (ou un sous-ensemble de séquences) existantes. BLAST @ Wikipedia
  • cDNA Par convention, le cDNA est la copie conforme du l'ARN m (T remplaçant U); c'est une notion purement "in silico": un cDNA n'existe pas dans la cellule à proprement parler. ➞Ce n'est donc pas le brin lu ou brin matrice notamment à cause des introns en moins, poly A en plus... -D'autres (source) le définissent comme ADN simple brin, qui est une copie d'un ARN obtenue par une transcription inverse. Ce n'est alors pas le brin lu ou brin matrice mais par convention le brin "sens" ou brin codant La séquence d'un gène (DNA génomique) correspondant à la séquence du mRNA (T remplaçant U et les introns en moins, poly A en plus....) ➞Le DNA génomique est donc également une copie "conforme" (du point du vue du sens de la séquence; i.e. il ne s'agit pas de la séquence inverse) du cDNA donc de l'ARNm..... CoDing Sequence (CDS) Région d'un mRNA codant pour une protéine, comprise entre le codon codant pour la première méthioinine et le codon STOP. Fasta (format fasta) : Format (convention d'écriture) d'une entrée dérivée d'une banque de séquences qui contient un minimum d'information et qui est compatible avec la plupart des outils informatiques. Une entrée en format Fasta commence par > puis le nom du gène ainsi que de l'organisme duquel il est dérivé, suivi de la séquence (ADN ou protéine) en « raw data » : les lettres du code à une lettre en majuscule . Exemple : >HSGLTH1Human theta 1-globin gene CCACTGCACTCACCGCACCCGGCCAATTTTTGTGTTTTTAGTAGAGACTAAATACCATATAGTGAACACCTAAGA CGGGGGGCCTTGGATCCAGGGCGATTCAGAGGGCCCCGG....
  • Locus (loci au pluriel) : position d'un gène sur un chromosome - généralement utilisé dans le contexte mendélien.
  • Homologue Protéines ou gènes qui sont similaires et qui ont une origine commune. Des protéines homologues découlent de la divergence de 2 gènes dérivés d'un ancêtre commun. Il ne s'agit pas d'un synonyme de « similaire » : 2 protéines similaires ne sont pas forcément dérivées d'un ancêtre commun. Une similitude de plus de 25% au niveau des acides aminés (25 acides aminés identiques sur 100) et de plus de 70% au niveau des nucléotides est considée comme une "homologie" ( Claverie & Notredame p 229) Paralogue Protéine homologues qui ont des fonctions différentes mais liées, au sein d'un même organisme. Orthologue Protéines homologues qui ont des fonctions différentes mais liées, au sein d'organismes différents.
  • Protéome Ensemble des protéines d'un organisme vivant. Signal Séquence d'une protéine (en N-terminal) qui permet de « diriger » la protéine nouvellement synthétisée dans la voie secrétoire de la cellule. Le signal est clivé dans la forme mature de la protéine.
  • Glossaire dans chromosomewalk
  • Glossaire dans precisionmed/

Retour à Bioinformatique : opportunités pour l’enseignement